CACTUS

LAB. SKELETONs

Research Proposal

Screening of Genetically Modified Foods in Nepal

Investigator: - Anil Chongwang
Supervisor: - Prabhat Khadka, Gyan Sundar Sahukhal

Introduction:

Background:

Biotechnological procedures have been employed since very long period of time to produce human foodstuffs to overcome the down of agriculture and to meet the agricultural fulfillment. We are introduced to various modern biotechnical techniques for the preparation of genetically modified foods. Year after year ancient people selected and saved seeds from plants displaying specific traits later, with cross breeding and the development of hybrid plants; traditional plant breeding emerged(Brandner, 2002). Genetically modified foods have been available since 1990's; with the principal ones being derived from plants; soybean, maize, canola and cottonseed oil. The first commercially grown genetically modified food crop was the Flavr Savr tomato, which was made more resistant to rotting by Californian Company Calgene.

Theory:

In this scientific era, Genetic Engineering has played a significant role in agriculture. Using genetic engineering techniques, scientists are able to make modification on crops. Those crops or foods that are obtained by genetic engineering techniques, which confers, altered genomes to produce both new and useful traits or phenotypes are called transgenic foods or genetically modified foods/crops. This is carried out by the insertion of foreign DNA or genetic material into the host genome. Vector is responsible for the transformation of interest genome in the new host. Vector is a circular DNA molecule capable of independent existence and replication; in which the gene or DNA of interest is introduce such that it can be transformed in new host. In plants; Agrobacterium tumefaciens Ti plasmid vectors are commonly used. Combining genes from different organisms is known as recombinant DNA technology. The tumerous transformation of plants by Agrobacterium tumefaciens results from the stimulation of plant cell division by gene products encoded by segment of DNA (T-DNA), i.e. transfer DNA. The expression of gene is activated by inducing virulence (vir) region of Ti plasmid..(Zupan et al., 2000)

Fig. 1. Ti plasmid structure of Agrobacterium tumefaciens

Generally three different methods have been used to introduce foreign DNA into new host;
1.Biological vectors (Ti plasmid from Agrobacterium)
2.Physical methods (particle gun or electroporation )
3. Chemical methods ( Polyethylene glycol & Calcium chloride) (Hemmer, 1997)

Out of these three methods; biological vector method system exists often. Vector containing interested gene must be controlled in new host by a promoter sequences and a terminator sequences. This grouping is called a gene cassette.

Fig.2. A gene cassette

Many potential promoter elements have been identified; but the most commonly used is the CaM35S promoter derived from the phytopathogenic cauliflower mosaic virus (Spoth and Strauss, 2000). The NOS terminator from the Ti plasmid in Agrobacterium is the most common terminator (Brandner, 2002). Manipulation of DNA is done by introduction of interested genetic fragments so as to produce a useful plant variety possessing the desired characteristics.

Modification of crops or foods can produce several benefits not only in agriculture beside that it proved to be beneficial to the environment as well. However genetically modified foods are beneficial to humans in several ways such as: -

- Agricultural: - due to increase in yield
- Environmental: - by reducing the use of pesticides, herbicides and fuel.
- Nutritional: - by improving quality of foods
- Disease prevention: - foods that work like edible vaccines etc. (Brandner, 2002)

This relies that genetic modification leads to the agricultural benefits with the improvement in productivity and profitability while at the sometime reduces reliance on pesticides and herbicides (Whitman, 2000). Moreover, genetic modification can improve food quality, which can overcome the nutritional requirement in human beings. For e.g. golden rice, the yellow colored grains, which are produced by rice genetically altered to make b-carotene; a pigment that is converted into Vitamin A in our body. This golden rice are made with the purpose to overcome vitamin A deficiency generally found in children so as to prevent them from blindness, immune system impairment an even from early death (Rusting, 2000).

Foods that can be engineered to combat human disease offer enormous advances in public health. One day, children may get immunized by eating foods such as bananas, potatoes and tomatoes. The modified plants could be grown locally at low cost eliminating problems of vaccine transport and refrigeration. Edible vaccines would not require syringes or other equipment, which often contribute to infection and disease spread upon reuse (Landridge, 2000). Beside various advantages of genetically modified foods, these foods may also lead to the human health risks(Hodgson, 2001). It may give rise to food allergens and may become threat to the global centers of crop diversity too.

Detection of genetically modified foods can be done by two basic methods. One method is based on the test of food for the product of transgene, usually a protein which is carried out by ELISA method. As protein may undergo denaturation during heat processing thus it is less effective. The other method involves the test for the presence of DNA from transgene or another portion of the gene cassette. In contrast to ELISA method, this method is effective. In addition, screening of genetically modified foods can be designed based on the presence of cauliflower mosaic virus (CaMV)35S promoter, the nopalin synthase (NOS) terminator, and the kanamycin-resistance marker gene (npt II). But plants in the cabbage family should be treated carefully because these plants may be naturally infected with the Caulimovirus, the source of CaMV35S promoter. In such cases further PCR tests should be run with primers designed to amplify the specific transgene DNA.

General Objectives: -

- Detection of CaMV35S promoter and nos terminator sequence in genetically modified foods

Specific Objectives:-

- Isolation of DNA from genetically modified foods
- To detect 35Spromoter and nos terminator sequence from genetically modified foods by PCR method.

Materials: -

Equipment

Micropipettes, Microfuge tubes, Autoclave, pH meter, Thermometer, incubator, waterbath or dry bath, Vortexer, Centrifuge machine, Thermal cycle, Gel electrophoresis apparatus, UV transilluminator, Assorted beakers, graduated cylinders and storage bottles

Materials and Consumable Lab Supplies

Dried food sample, Tris-HCl, NaCl, TAE buffer, EDTA, SDS, PCR primers, TE electrophoresis buffer, Taq DNA polymerase, Mineral Oil, Blue juice (Loading Dye), Deionized or distilled water,
Ethidium bromide 10 mg/ml, Grinding buffer, Suspension buffer, Ammonium acetate, DNA Marker...

Solution Preparations

-Grinding buffer :-
Sucrose 15 %( w/v)
Tris-HCl 50mM
EDTA 50mM
NaCl 250mM
Adjust pH 8.0. Autoclave and store at 4°C.

-Suspension buffer:-
Tris-HCl 20mM
EDTA 10mM
Adjust pH 8.0. Autoclave and store at 4°C.

-20% SDS(10ml):-
SDS 2gm

-TE buffer:
Tris-HCl 10mM
EDTA 1mM
Adjust pH 8.0. Autoclave before use.

-TAE buffer (50X):-
Tris-base 242gm
Glacial acetic acid 57.1ml
0.5M EDTA 111ml
Adjust pH 8.0. Autoclave and store at 4°C. Make 1X solution.

-Blue juice:
Glycerol 350ul
0.25M EDTA 40ul
20%SDS 5ul
10% bromophenol blue 30ul

-PCR Marker: -
Use 6 μL per gel lane. Store in refrigerator.

-Ethidium Bromide stain 1 μg/ml :-
Add 50 μL of 10 mg/ml ethidium bromide to 500 ml of deionized or distilled water. Store in unbreakable opaque bottles at room temperature.

-Oligonucleotide Primer Sequences: -

35S Promotor
Sense 5’GAATCCTGTTGCCGGTCTTG3’
Antisense 5’TTATCCTAGTTTGCGCGCTA3’

NOS terminator
Sense 5' GCTCCTACAAATGCCATCA 3‘
Antisense 5' GATAGTGGGATTGTGCGTCA 3'

(BIONEER Comp. RLABB)

Methodology:-

DNA isolation protocol

1. Take sample and keep it in -20°C for at least 1 hour.
2. Homogenize it by adding 0.5ml grinding buffer and rinse the mortar by adding 0.5ml grinding buffer. Transfer the fluid to a 1.5ml centrifuge tube.
3. Centrifuge at 8,000rpm at 4°C for 5min.Remove supernatant.
4. Take pellet and add 1.8ml of suspension buffer in it.Transfer 300ul of the suspension in 6 microfuge tubes.
5. Add 20ul of 20% SDS in each microfuge tubes.Mix by inverting.
6. Heat the tubes at 65°C for 15min in waterbath.
7. Add equal volume of phenol: chloroform(1:1). Invert the tubes gently for 5-10 times.
8. Centrifuge at 8,000rpm for 5min.
9. Transfer the upper (aqueous) phase to fresh tubes.
10. Repeat the above step. Take upper phase. Add 0.1volume of 3M sodium acetate.
11. Add 2 volume of cold ethanol. Keep at -20°C for overnight.
12. Centrifuge at 13,000rpm for 10min.
13. Remove supernatant. Wash the pellet with 1ml of 70% cold ethanol.
14. Centrifuge at 13,000rpm for 10min.Take pellet and dry it.
15. Dissolve the pellet in 50ul of TE buffer.
16. Dilute 25ul of DNA sol to 0.5ml with TE buffer.And measure OD at 260nm and calculate the quantity of DNA.
____(Walbot V, 1988)

DNA Quantization by Spectrophotometer- Absorbance Assays:

1. Remove the DNA for assessment cold storage and heat at 37 °C for 30 mins. Flicking the bottom of tubes ensured that the entire DNA has been suitably resuspended.
2. The samples will be then given a quick spin in a microcentrifuge and kept on ice prior to use.
3. Aliquot 2.00ml of Filtered TE into quartz cuvette and use to zero the spectrometer=1st cuvette
4. In a second cuvette 10ul of the DNA sample will be pipette pump in 1.99ml of TE=sample cuvette. After blank setting the spectrometer on the 1st cuvette, the sample will be bring into place to obtain an absorbance reading
5. Readings will be taken at wavelengths of 260nm (OD280) (the spectrometer must be rezeroed between each wavelengths reading)
6. (260nm for nucleic acids and 280nm for protein concentration)
7. The ratio between the readings (OD260/OD280) provides an estimation of sample purity. Pure preparations should have values close to 1.8 and protein contaminated samples are significantly lower. OD260 allowed the calculation of nucleic acids concentrations of the samples, i.e. An OD of 1 corresponds to approximately c.50ug/ml for double stranded DNA.
____(Sambrook et al., 1989)

PCR ANLAYSIS

PCR Amplification is carried in a total volume of 25ml containing the following reaction mixture (Brandner, 2002).

PCR reaction mixture for Genetically Modified Foods

PCR Thermo-cycling program (Brandner, 2002).

Agarose Gel Electrophoresis:

1. 0.3gm of agarose gel will be measured and 35ml of 1X TAE buffer will be added to make 1%agarose gel in a 100ml conical flask
2. The mixture will be heated on a high microwave setting for 1-2 mins or until all solids or viscous agar will be melted and the solution starts to boil.
3. Then it will be left to cool until hand hot (55°).
4. 17ul of ethidium bromide (1mg/ml) will be added after the mixture will be cooled and will be gently mixed into agar
5. Then the gel will be poured in the gel doc and comb is fit and it is allowed to solidify
6. Once set, fit the gel doc into the electrophoresis tank and remove the comb carefully
____(Sahukhal, 2006)

What is expected ?

Presence of DNA bands size of PCR product within range 180-195 bp in the gel indicates the presence of the CaMV35S promoter. No DNA bands should be observed in the negative control i.e. for normal food.

Fig:3 Expected result, Lane 1, 2 & 5 Negative control; Lane 3, 6 & 7 Positive control and Lane 4: Molecular Marker.

Any new ?

In context of our country, the GMO food is not identified yet. The Food and Agricultural Administration of Nepal Government does not have any documentation about GMO food yet. We could use this method to determine whether it is GMO food or not so that we can aware people about it.

References:

Brandner DL (2002) PCR-Based Detection of Genetically Modified Foods. Tested studies for laboratory teaching 23: 69-84

Hemmer W (1997) Foods derived from Genetically Modified Organisms and Detection method.

Hodgson E (2001) Genetically Modified Plants and Human Health Risks: Can Additional Research Reduce Uncertainties and Increase Public Confidence? TOXICOLOGICAL SCIENCES 23: 153-156

Landridge W (2000) Edible vaccines. Scientific American 283: 66-71

Rusting R (2000) Moving Against Malnutrition. Scientific American 283(3): 70

Sahukhal GS (2006) Study of Genetic Polymorphism among Bacillus thuringiensis isolates from Khumbu Base Camp of Everest region by Randomly Amplified Polymorphic DNA Polymerase Chain Reaction. Tribhuvan University, Kirtipur, Kathmandu, Nepal.

Sambrook J, Fritsch EF and Maniatis (1989) Molecular Manual, Ed 2. Cold Spring Harbor Laboratory Press. Cold Spring Harbor, New York

Spoth B and Strauss E (2000) Screening for Genetically Modified Organisms in Food Using Promega’s Wizard¨ Resins.

Walbot V (1988) Preparation of DNA from single rice seedlings. Rice VX. Newslett. 5: 149-151
Whitman DB (2000) Genetically Modified Foods: Harmful or Helpful? In. CSA Discovery Guides
Zupan J, Muth TR, Draper O and Zambryski P (2000) The transfer of DNA from Agrobacterium tumefaciens into plants: a feast of fundamental insights. The PlantJournal 23: 11-28

suva

she is ma fren.she is cute sometimes she behaves like a year kid....but still she is naughty.this is all but least about her.